complementSeq          package:matchprobes          R Documentation

_C_o_m_p_l_e_m_e_n_t_a_r_y _s_e_q_u_e_n_c_e.

_D_e_s_c_r_i_p_t_i_o_n:

     Function to obtain the complementary sequence.

_U_s_a_g_e:

     complementSeq(seq, start=1, stop=0)

_A_r_g_u_m_e_n_t_s:

     seq: Character vector consisting of the letters A, C, G and T.

   start: Numeric scalar: the sequence position at which to start
          complementing. If 1, start from the beginning.

    stop: Numeric scalar: the sequence position at which to stop
          complementing. If 0, go until the end.

_D_e_t_a_i_l_s:

     The complemented sequence for each element of the input is
     computed and returned.  The complement is given by the mapping: A
     -> T, C -> G, G -> C, T -> A.

     An important special case is 'start=13', 'stop=13': If 'seq' is a
     vector of 25mer sequences on an Affymetrix GeneChip,
     'complementSeq(seq, start=13, stop=13)' calculates the so-called
     _mismatch_ sequences.

     The function deals only with sequences that represent DNA. These
     can consist only of the letters  'A', 'C', 'T' or 'G'. Upper,
     lower or mixed case is allowed and honored.

_V_a_l_u_e:

     A character vector of the same length as 'seq' is returned. Each
     component represents the transformed sequence for the input value.

_A_u_t_h_o_r(_s):

     R. Gentleman, W. Huber

_S_e_e _A_l_s_o:

     'basecontent', 'reverseSeq'

_E_x_a_m_p_l_e_s:

      seq <- c("AAACT", "GGGTT")
      complementSeq(seq)

      seq <- c("CGACTGAGACCAAGACCTACAACAG", "CCCGCATCATCTTTCCTGTGCTCTT")
      complementSeq(seq, start=13, stop=13)